Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ956148
Length 762 bp
Fasta Format > whchul10a12
tatgcgttccgtgcatatacatagccaccgatagcattcacatacgagca tgctttctcgagccatgttggtacatgaacatggacatacacatattctt aggaacaaataagaaagataaatggagaaggaaaacccaaagcaatgtca gagttgacaaaactgcaatggcactttatatatggcctgtcgtgagtgag ctgtttaggccttgccggactcctcgcagcccggtggcttgaaggcgatg aagctgacgcactgcacctgacgcatgttgtcgaatccgatgatgcggac atacgcgtcagggtactccttcttgacctcctccacctcgttgatcacct gtgtggcgtcagtgcacccgaacataggcagcttccacattgtccaatac cggccatcgtagtacccaggagatgcgttgtgctcacggaagatgaaccc aaccttgctgaactcgaggcaaggcacccacttggagcggatcaggtagt cgacctgcttgaggagggcctccgtgctgagcggtggcaggtaagacagg gtctcgaacttcttgatgccctcgatgggccacacctgcatgcacctgat ccttccaccgttgctgacgctgccgaggctagcgccgttggagcggcggc tgacggggaggccggcggtggacttgagcccctggaaaggagcgacggan gtggccgacgaggccatcacggtgggggccatggctgtactatgtaggta tatagcttgcta
Download
page-top