Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ956147
Length 769 bp
Fasta Format > whchul10a10
aatattatgcgtccgtgcatatacatagccaccgatagcattcacatacg agcatgctttctcgagccatgttcgtacatgaacatggacatacacatat tcttaggaacaaataagaaagataaatggagaaggaaaacccaaagcaat gtcagagttgacaaaactgcaatggcactttatatatggcctgtcgtgag tgagctgtttaggccttgccggactcctcgcagcccggtggcttgaaggc gatgaagctgacgcactgcacctgacgcatgttgtcgaatccgatgatgc ggacataggcgtcagggtactccttcttgacctcctccacctcgttgatc acctgcgtggcgtcggtgcatccgaacataggcagcttccacattgtcca gtaccggccatcgtagtacccaggggatgcgttgtgctcacggaagatga acccaaccttgctgaactcgaggcaaggcacccacttggagcggatcagg tagtcgacctgcttaaggagggcctccgtgctgagcggtggcaagtagga cagggtctcgaacttcttgatgccctcgatgggccacacctgcatgcacc tgatccttccaccgttgctgacgctgccgaggctagcgccgttggagcgg cggctgacggggaggccggcggtggacttgagcccctggaaaggagcgac ggangtggccgacgaggccatcacggtgggggccatggctgtactatgta ggtatatagcttgctagga
Download
page-top