Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ956144
Length 712 bp
Fasta Format > whchul10a04
catcgattcttaagaaaatacaattgaaaaaatattatcacttatcagct aagagagtactccagctaagaagatacagagccttctgcacacagtcttc tcttcagtttcttgatcctctgttcagcagaggggcaagggctcaccgtt ccactcttttaggcactccagcagcgcgtcgatgtgcttgccctggttca tggcgacaaacaccttgtccacctcttccccaggagaccgtgtcttctcc ccagtcaagtactcagtcccaagctccttgcgcacgaacctgtagagcgg gtatgaccggcattcggtgatacggttctgctgtgtggcggtgccgttct ccacggaggtccgggcagcctcaacctcctttggtagcactgcacggagc tcctgctcgaacgcggcaagcttggcaaagacggatgtctccacgtcgcg ttcggcctcaccattggccaaggcgtgctccacgagaaccgcacgcatct tctgcatcaatgggtagttggcgctgcaagggtcatctgcatacgcaaac accgcctcacggtcaatcgtgagcagcaggtctttctcgcagaatcgcgc attgtggaggtgcccattgttggtggtgctcaatgtcttcctggccgtca tcttcacgcagctcttgacggcatccttgacattctcctcaagatggcgg angtcgatggct
Download
page-top