Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ956143
Length 625 bp
Fasta Format > whchul10a02
agagcagaagctttctggcgtgcttctttacaaggaaaagctctcctaaa tgctcctaggcttatttttgtgatacagactacaaacactttgacagact ataggatctgcctgctactcaaagtaccgcggacacacatatttacagat ccacaagtaccgggcatggactcctgcatctctaaaacttcagcatggcc tccaacgcgcgaagaacgtcatcgcgggtaactatacctattacttgatt gtcctggtttactatcggtaatctgtggatcttcttcctgagcatcagag ctgcggcatcggtcactgttttatcgcatgatagtgtgattgctggagat gtcatcacatccgcaatcttcgtctttggcccatgtgaagccctcacgcg atcgctcttgacgacgaccccgacacatcggcgggcgctgtcgacaaccg ggaggcctgacacgagctgaaagtggccttcaatctccaccagcgcctgc tcggctgtgaccatcagcacgggcgtcgacatggcctcgcgcaggagcgg cccccgctgctgatcgccggcatgggatggttgttgttgttgctgctgct gctgtgactggaggtatgcgcggag
Download
page-top