Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ248799
Length 684 bp
Fasta Format > whf8b01
ttcggcacgaggcagacccctcccctcccctcccctcccccaacccaccg gcggcggcgcagcgcagcttgaggaaggaagcgaagatggtgaagttcct gaagcccggcaaggcggtgatcctgctgcagggcaggtacgcggggaaga aggcggtgatcgtgcgcgtgttcgaggagggcacccgcgaccgcccgtac gggcactgcctcgtcgccgggctggccaagtacccgaagaaggtgatccg caaggactcggccaagaagacggccaagaagtcccgcgtcaaggtgttcc tcaagctcgtcaacttcacccatctcatgcccacccgctataccctcgac gtcgacctcaaggaggtggcctccggcgcgcccgactccctcacctccaa ggacaagaaggtgggcgccgccaaggccgccaaggccaagctcgaggaga ggttcaagaccggcaagaacaggtggttcttcaccaagctccgcttctag gccggccggccgcgccagggcggtctctgccgttattactacccgaaccc tttacatttttagttgcttgttatcggtgactgttgctgcgcttaaggtg tcctgttttggtattgcccatgaagaagactctgtgtttagcttggatct tatgagatatgatgatgtttcatgtgttaaaaaa
Download
page-top