Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ944254
Length 709 bp
Fasta Format > whchul10f11
tatggtagagcgtgttatgagtgtctacgtggtggacttgattttaccaa agatgatgaaaacgtaaactcacaaccatttatgcgctggagagaccgtt ttgtcttttgtgccgaagctatttataaatcacaggccgaaaccggtgaa atcaaggggcattacttgaatgcgactgcgggtacatgtgaagaaatgat taagagagctgtatttgcaagagaattaggggttcctattgtaatgcatg actacttaactgggggattcaccgcaaatactactttggctcattattgc cgcgacaatggcctacttcttcacattcaccgtgcaatgcatgcagttat tgatagacagaaaaatcatggtatgcatttccgtgtattagctaaagcat tgcgtatgtctgggggagatcatatccactccggtacagtagtaggtaag ttagaaggggaacgcgaaatgactttaggttttgttgatttattgcgcga tgattttattgaaaaagatcgtgctcgcggtatctttttcactcaggact gggtatccatgccaggtgttataccggtagcttcaggtggtattcatgtt tggcatatgccagctctgaccgaaatctttggggacgattctgtattaca atttggtggaggaactttaggacatccttggggaaatgcacctggtgcag cagctaatc
Download
page-top