Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ944251
Length 608 bp
Fasta Format > whchul10f01
aatcgattctcctcctcggcggcggaaggcgaacagcgaggaaccctaac cctaaccctaaccgcgctccgatccgatccgatccgcaaggcctgcgacg atggcggcttccctccgcgcggcggccaagaggatgctgcgcccggcggt gcatccaggggaggggcttcgcacccagcaccagcagcattccggaaccc cccgtgccttggatgaaggatacaaccatgcatcgcaaatccagcagaag aaggaggagttgtacaatctcatcgccaaggctgtggcggagcccactac cacctggctggacaggcgactgctcaaggctctctccttgcaaatcaagc ctagaccaaaggaccctcagtggcgcaagataattttgaccaaggtggcc acccattgtacatatgctgtgggtattcttgttgcttatgtcagatgtcc tcgcactgaagacggtgctaaaatagtaaggtacgatggacatcttgtta ctgttgagagtctgcccatgctacaaggatatcagcctgctactcctgct gagggagtgcccaagcaaatgagttgaagaagaaatgcagcttgtttttg atggagaa
Download
page-top