Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ944244
Length 513 bp
Fasta Format > whchul10d09
tgcagcactccggcgggccgttcggcgagaacatcttctggggttccggg cagtcgtggacggccgccgacgcggtgaagctgtgggtggacgagaagca gaactaccatcttgacagcaacacctgcgacgccggcaaggtgtgcgggc actacacgcaggtggtgtggcgcaagtcgacccgcatcggctgcgcgcgc gtggtctgcacggggaaccggggcgtcttcatcacctgcaactacaatcc cccgggcaacttcaacggcgagcgcccgttcgcgttcctcacccttgacg ccgaagcctagtacgtgcgagtgagtgtgatcatacatgcatacgtacgt gcgtgtgtttatgtttgtgtggtttgaatatttatacgtctacaaatgtt acgtacgtacgtaaataagcacacattccggcctgcatgtatccatgcgg ctctgtggagcgtgtaaatgtatgcaaacatctttacttttgttttgttg ttcaaaaaaaaaa
Download
page-top