Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ944242
Length 767 bp
Fasta Format > whchul10d05
aatctcgtctccgatcgaccccaggctcgtcgaatcctcctcccccgccg cctcaagatgcagatctttgtgaagaccctcaccggcaagaccatcaccc tcgaggttgagagctccgacaccatcgacaacgtcaaggccaagatccag gacaaggagggcattcccccggaccagcagcgccttatctttgctggcaa gcagctggaggatggccgcacccttgctgactacaacatccagaaggagt ccaccctccaccttgtcctgcggctgcgtggtggcatgcagatcttcgtc aagaccctcactggcaagaccatcacccttgaggttgagagctccgacac cattgacaacgtcaaggccaagatccaggacaaggagggcattcctccgg accagcagcgcctcatctttgctggcaagcagctggaggatggtcgcacc ctcgctgactacaacatccagaaggagtccaccctccaccttgtcctgcg tctgcgtggtggcatgcagatcttcgtgaagaccctcaccggcaagaccg tcacacttgaggtggagtcgtctgacaccattgacaatgtcaaggccaag atccaggacaagggagggcattcccccggaccagcagcgccttatctttg ctggcaagcagctggaggatggccgtaccttgctgactacaacatccaga aggagtccaccttcacntngtcctcngccttcgggagnatgcaaatcttc gtcagacctcacgggna
Download
page-top