Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ944237
Length 433 bp
Fasta Format > whchul10b13
agcgatgccgaagaanatgatgatgtacttgacctgggaattcttccnaa aagcacacaccgatgatggttctttatacaggaacactcatttgtggaaa agggattatnatgttgatgaccctagtgagactcggctaccagatcccac agattgcgacatccgcaatgnagaatgcattcggcatctacctaatcgcg tgttacaaattttctcattaaagttggctgaacttactgtggatcttggc ccantanagttgtatggatacatagcagngcgagattatctggatacatt gcgcaattatgttgttaatataagcaggnatgatcccatcattgtgaagc anggttctctcatcgacatggctggccctaagcgagggatagatttgatt tccactattctagtggaatatgacatgcggatc
Download
page-top