Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ944234
Length 554 bp
Fasta Format > whchul10b05
cagactttgaggtttggacctcgggaaaatggaccaggctaacgattcag gactagcttcatatgtcgccggccaaatcgaccgcacactgagctggaag gatgtgaagtggctgcagtccatcaccacgatgccgatcctggtgaaagg agtgatcaccgcagaggacagcaggctcgccgtcgagaacggcgcggccg gaatcatcgtgtccaaccacggcgcccggcaactggactacgtcccggcg accatcagcgccctggaagaggtcgtgaagggtgctggcgggcagatccc cgtcttcctggacggcggtgtgcgccgcggcaccgacgtcttcaaggcgc tcgctctcggcgccgccggcgtcttcatcggaaggccggtggtgttctcg ctggcggtggccggggaggccggggtgagcaacgtgctcaagatgctgcg cgacgagttcgagctgaccatggcgctgagcggctgcaactcgctggccg acatcacccgcaaccacgtcgtcaccgaggccgacaaattcggcgtcatg ccgt
Download
page-top