Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ944233
Length 660 bp
Fasta Format > whchul10b01
cgagatggaaggcccgctcgaggtcggcgccgacggcaccctcaagttcg aggagaaggacggcatcgactacgcggccgtcaccgtgcagctccccgga ggcgagcgcgtgcccttcctcttcaccgtcaagcagctcgtcgccaccgg caagcccgagagcttcagcgggcccttcctcgtgcccagctacaggggtt cgtctttcctcgacccaaagggccgtggtggctctactggctacgacaac gccgtggcgctacccgccggaggcagaggagacgaggaggagttggccaa ggagaacgtgaagaacgcgtcctcctccacgggcaacatcacgctcagcg tcaccaagagcaagccggagaccggcgaggtgatcggcgtcttcgagagc gtgcagccgtcagacaccgacctcggcgccaaggcgcccaaggatgtcaa gatccagggtgtgtggtacgcgcagctcgagtctaactagagcagagcag aagtgaagatactcatcttgtgtgcatgcgtacgtgggttgatcggtgga gaggaaacaatcgaggcaacaatgtgtgtttgtgtgtgtatctagtaatc taaacccagggtgtcggtttatattttagcttctgttattgtttcttcct aaaaaaaaaa
Download
page-top