Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ944231
Length 654 bp
Fasta Format > whchul10o19
ccagaaccagctaaaccctaccatcttccgcttcctctccaccggcggcc tccccggtcagatcaccatgtcgacggagaagaagcagttgaacacgatg cgggagatcaaggtgcagaagctcgtcctcaacatctccgtcggcgagag cggcgatcgcctcactcgagctgccaaggtgttggagcagctgagcgggc agtcgccagttttctccaaggcgaggtacactgtcaggtctttcggcatt cgtcgtaatgagaagattgcctgctatgtgacgatcaggggtgagaaggc aatgcagcttctcgagagtgggctgaaggtgaaggagtacgagctcttga ggaggaacttcagtgacactggttgctttgggtttggtattcaggagcac attgatcttggcatgaagtatgacccatcaaccggcatctacggtatgga cttcttcgtggttctggagcgagctggataccgcgtctcccgccggcgcc gatgcaaggcccgtgttgggatccaccaaagggtgaccaaggaagacgcc atgaagtggttccaggtcaagtatgagggtgtcatcctgaacaagtccca cgctagctagtaacctttcgagtgattgagttgtcgttagagcttcaagt cagt
Download
page-top