Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ944227
Length 357 bp
Fasta Format > whchul10o11
ggacggcatccagatcgagatgcaggccactgaccccagcgaaatcagcc tggacgtgatcaaggagcgcgcgcactaaggcaaatcatcccaatgcctc gcaatatggatttatgtcaaatatagatttggcggtgtgactcttgaaac tttcttgatgatttgtggctttgttaccgtgtcgaaaggccctcctcccg tggtccgtgtgaccacggagggcttgctctatcatgtaatctgttctttt tcttctgcccatttatatgccgggccttatgctgctgcactgcactgttc ctccaagttacggttataaataattaaatgttctgtttggattcgtcaaa aaaaaaa
Download
page-top