Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ944224
Length 666 bp
Fasta Format > whchul10o05
cttcgacaaggaacggagatggttgcatcaccaccaaggagctgggaaca gtcatgcgttcgctggggcagaacccaacggaggctgagctccaggacat gatcaatgaagtcgatgctgatggcaacggcaccattgacttcccagagt tcctcaacctgatggcccgcaagatgaaggacactgactcagaggaggag ctcaaggaggccttcagggtgttcgacaaggaccaaaacagtttcatctc tgctgctgagctccgccacgtcatgacgaacctcggtgagaagctcaccg acgaggaggtggacgagatgatccgtgaagccgacgtcgacggtgatggc cagatcaactacgaggagttcgtcaaggtcatgatggccaaatgagctcc gacccaaatgctccgaagacaggaggagaattgtgcattgcatattagtt taagatgcaactcttatttgatcgatttccagttaagcatcctacctagc tgtagctgctaaaacggatcggacgacgcaattcctgctatgttctccag tgtgtttccagacctcttgtgttttatgtgaacttgtgtcctccctggtg tatcctgattgctgtttggcccgtttgtagtatattttttcatcaacttc tgcttgaaaaaaaaaa
Download
page-top