Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ944221
Length 662 bp
Fasta Format > whchul10m23
atggccccagccgtgatggcatcgtccgccaccaccgtcgcgcccttcca ggggctcaagtcgaccgccggcctccccgtcagccgccgctccggcagcg ccggtctcagcagcgtcagcaatggcggaaggatcagatgcatgcaggtg tggccgattgagggcatcaagaagttcgagaccctgtcttacttgccacc cctctccacggaggccctcctaaagcaggtcgactacctgatccgctcca agtgggtgccctgcctcgagttcagcaaggttggcttcgtcttccgtgag cacaacagctcccccggctactacgacggtcgatactggacaatgtggaa gctgcctatgttcgggtgcaccgacgcaacgcaggtgctcagcgaggtgg aggaggtcaagaaggagtaccctgatgcctatgtccgcgtcatcggcttc gacaacatgcgccaggtgcagtgcgtcagcttcattgccttcaggccacc aggctgcgaggaatctggcaaggcctaaagtgcaagttgaagtaacgcat atacatgccatgttagttcacatttgtcggcagctctgctttctcggttt tacttctcgtactactcgtatgtgaatacatgagcatatgtatgtaagca cctaccaacgta
Download
page-top