Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ944218
Length 202 bp
Fasta Format > whchul10m17
gcggcatccagctggttatctatgcggtgtacatgaacagcaaggtcgcc tctcactcttatggcagcgacgaagcggcttcccttttgtcctccgaggc cagcaaacatggccagcacgatgcatccactcgtgtttagtgattgtgta aaattatgtaatttttgctgagtaaagtccaactcttatcacaaaaaaaa aa
Download
page-top