Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ944217
Length 526 bp
Fasta Format > whchul10m15
aatgaaggaaataaaacgagaaaggtggttggtacatatggctacatggc acccgagtatgcttcccatggcctcttctctgtcaaatcggatgtattca gctttggtgttttagttctcgagatcattagcgggaaaaagaattcccat gagtgtggagctttcatcaacctcattggatatgcttggcaattatttga agaggaaagatggatcgaactcgttgacgcggcattgattcccagcggtg gttcgtcagaaatgatgaggtccattaacattgcgttgttgtgtgtacaa gaagatgcaattgatcgaccgaccatgttggatgttgttgcaatgctaag cagcaagactatgaccttaaataagcctaagcacccagcatattacagca taagtagtgtaggcaacaaagaagcatccgctggtactaagtcttgtagt tttaatgatgtgactatatctacgataactcctagatagcttatcttcgt ataaatgttatttttcactttgaana
Download
page-top