Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ944209
Length 661 bp
Fasta Format > whchul10k23
ctcggttccatgctgttcataagctgtggaaatggcaacgcagtgacagg aatcctaatggcaagtctactgcatctatttcgcctcacctgtggcaacc agcaaatgggattctaatgacaaatgacacaagtgatggcaacccagaag aagcaactgcctgcattgcgttgtctaaaaatgactcctatgttatgtct gcatctggtggcaaagtctctttgttcaatatgatgacgttcaaggtcat gactactttcatggcacctccacctgctgcgactttcctcgcattccacc cacaggacaataatattattgctataggaatggaggactcgaccattcaa atctacaatgtccgtgttgatgaggttaaaagcaagctcaagggtcatca gaaaaagattaccggactggcattttctcaatcaatgaatgttcttgtat cttcaggtgctgatgctcagctatgcgtctggagcattgatggttgggag aagaagaaatcaaaatatatccaacccccggcaaatcgctctggtgcttt agttggcgatacaagggtccagtttcacaatgaccaaacacatcttcttg tagttcatgagagccaactggcaatctatgatggaaatcttgaatgctcg cgctcgtggta
Download
page-top