Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ944208
Length 733 bp
Fasta Format > whchul10k19
acgagctcatcaagcactccgtcgcgcagtcccgcccggcctcgtgcgag ctgctcgagacctgcgactcccacggctggccgtccagccacgcgcagta caccttcttcttcgccacctacctctcgctcttcgtgctccggcggtcgc cggcgagccgcgtcatggcctccttctcatggcctctcgcgttcctcacc atgctctccagggtgtatctcggctaccacaccgtcccgcaggttttcgc gggagcagtagtcggccttgtatttggtgctatctggtactggttcgcca acaccattcttgctcaatacttcccaatgattgaggagagcgcaattggg aggtggttttatatcaaggatacttcacatattcaagatgtgctcaagtt tgagtatgataatgcaagggcagcaaggaagaaagtcgctactgattgag gattgcaggtttctgctcatggattatattgttggtctatctcagggagg gtaagaacttgtgtggcatggcaagatgtttgcttcgctgaagctgcacg cgaacccatgtactcctagctggacttttattagaagagaagcccgttgg agttgtggtgttttttcgcttttcctggccataagccattgttcttttta accccagacccttgtattattttggcgatgagttgattttcgtgtacatt tggacaaagaccacagtttttttgtacttgact
Download
page-top