Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ944207
Length 720 bp
Fasta Format > whchul10k17
ccccgttgagagtcgagagagttccaccgctcccggcccgatcccttatc ttctccgacggcctcgccggccggagcggagacgggagaggtgcatggcg ttgtcctatgtatatagaatctaggtataggttgaggtcgagtagtgccc atgtggcgtatggctgtatgccgatgtggagagcgccgccgccgcgtacg agcagcggctggtggctcacggtggctgcgtctcaggcaaggctggctgg cggccagtcgctgccgaggggcgtgctgctggctcatccaccaataagct cgtctggtcccctgttctggaggctctccgctacttctctagctcgtggc gtcgccgtggtggtgaagacgaagagtagaagagatggagaaccagatcg ggtcagtgctcttatccggtggctgtttgggagtggccttggcgccagct acggcgttcggcggccggccggctccatcacgtcatcgtacatgctggcc gaagggcggcctttctacttcttcctcccggccaagatgcctaaagggag gcagctcatcttctgcacggagtctatggcgtggtgccatggaagcttag ttgtcccaagtggcaatgtccccggcgacggcgaagttacggccgtgcag aagatgtcaaggacccgattgcttttcttatctggttgttggggtcctct ttgtaaagacagggaccagt
Download
page-top