Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ944203
Length 713 bp
Fasta Format > whchul10k05
tcgcgccccgtgcccgctcctccaccatcgtcgccagcctcggcaccccc gcgccctccaactcctcctccttccgccccaagctcatcaggaacacccc agtccaggccgcgcccgtcgcacccgcattgatggacgccgccgtggagc gcctcaagaccgggttcgagaagttcaagaccgaggtctacgacaagaag cccgatttcttcgagcccctcaaggccggccaggcgcccaagtacatggt gttcgcgtgcgccgactcccgtgtgtgcccctcggtcaccctgggcctgg agcccggcgaggccttcaccatccgcaacatcgccaacatggtcccgtcc tactgcaagaacaagtacgctggtgttggatcggccatcgaatacgccgt ctgtgctctcaaggttgaggtcatcgtggtgattggccacagccgctgcg gtggaatcaaggctctcctctcactcaaggatggcgcagacgactccttc cacttcgtcgaggactgggtcaggatcggcttcccggccaagaagaaggt gcagactgagtgcgcctcaatgcctttcgatgaccagtgcaccgtcctcg aaaaggaggccgtgaacgtgtccctccagaacctcttgacctacccgttc gtcaagganggtgtgtccaacggaaccctcaagctcgttggcggccacta cgacttcgtctcc
Download
page-top