Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ944199
Length 668 bp
Fasta Format > whchul10i17
aagctcccggcggcggcggctcgcaacctcatcccgcctctacgaccgcc tcatggccgccgccgcgtcagcaaaccccggcacagcgtacaagctcctc ctctcctgccccgaaggcctccctcgatcccgagtttgtgtgaggtttga tccgtccttcgaccggatcccccacccggacgcatccctggaggagtcta taggcgagatatggaatcaaaggctccagcagaacccatcgctgtacaac ggaacgaaatttcggtatggagggcatgccttgcaccgcagtgatgagtc aaatcatgagtactgtgtctcacttcatttgggactcacagattatagga catttgttggaacaaatctcagtccactgtgggagaaatttttggtcccc tctcaagatgactctgtgtgttgccaacacatgtcaaatccactgggaaa tggtgcaatcgttgaaacatctgatgaaaaaattattgtattgcaaagga gcaacaatgtcggcgagtctcctggacactatgtttttcctggaggacat tctgagccacaagaagttggaatcttggctcatcaaaatgacgaaaaaga tgttgctggtctcactgaaagaatttctgatgaaatgtttgatggaatca tccgtgaagtagttgagg
Download
page-top