Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ944195
Length 704 bp
Fasta Format > whchul10i09
accgcgaaggcagagccggaggaggaggaaaaatctgcggccgctagctc ctcgtcggccagtcagtcaccgccccgctacttatacactcggctcggct cgctccccttccctcacaatcgccctcttccccctcttccgccccggccc cgatccagctcatctcagtgagcaaacatggcgccatccatgagtcttgc ancgaaagggctgctccccttcggagcgctcccctcgagcggcgtcgcgc agaggccggtgtccgtgaccgcctccctggagcacaagccaaacgattct aagaggaagctactgaagcttgcgctcggaggagtcggcctgcccgcctt gctgagtgccaagaaggctcttgcggatgaccagggcgtctcctcctcca ggatgtcttactcgaggttcctcgagtacctcgacaaggacagggtgaag aaggtcgacctgtttgagaacgggacgatcgctatcgtggaggccatttc tcccgagctcggcaaccgcgtgcagagagtccgtgtgcagcttccgggcc tcagccaggagcttctccagaagttgagggagaagaacattgactttgct gcgcacaaccagcaggaggactccggtaatctcctcttcaaccttatcgg gaaacttggccttcccgcttatccttatcggcggtctgttcttgctgtcg agaa
Download
page-top