Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ944193
Length 658 bp
Fasta Format > whchul10i05
ctgtggaagatcgaagagagcagctcggagttcaccttgtacgacttccc tgagctcgccgctgccacggacaatttctccgaagagaacaagctcggac aaggtggcttcggtccggtttacaagggaaagttttctgacggggcggag gtggcggtgaagaggctggcggcgcagtccgggcaggggcttgtggagtt caagaacgagatccagctcatcgccaagctgcagcacacgaacctcgtca agctcgtgggctgctgcgtgcaggaggaggagaagatgctggtctacgag tacctgcccaaccgaagcctggacttctttatcttcgaccaggagcgagg gcccttgctggactggcagaaacggcggcacataatggaggggatcgcgc aggggctcctgtacctgcacaagcactcccgggtgcgcatcattcaccgg gacatgaaggccagcaacatactgctggacaaggatctcaaccccaagat ctccgacttcggcatggccaggatcttcggctccaacatgacggaggcca acaccaacagggtggtcggcacctacggttacatggcacctgagtatgct tcgganggcctcttctcggtcaagtctgacgtcttcagcttcggcgtgtt gctgctgg
Download
page-top