Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ944187
Length 461 bp
Fasta Format > whchul10g17
tcggcccgtggtctctgatggacgcggcgcagagcggggacgtgatcatg cggatgatggccaggaactccatgtcggagaaactggcgctggacatcga ctcggcggtgaagcagctgtcggacaaggcctatgagatcgccctgcagc aggtgagggacaaccgcgtggccatggacaagatcgtggaggtgctcctg gagaaggagacgctgagcggtgacgagttccgggccatcctgtccgagtt caccgagatccccgtcgagaaccgggtgcccccgacgccccaggccgccg tcccggtctaggttcgcccgcgtttatagggttggagaatttgctgttgt tgtaagatgttcatatttcttggatgtacactaattcctactcgaggcac ggcatgtaatgtaactcactcgcggttaattataagatgtaattaccagg gaaaaaaaaaa
Download
page-top