Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ944184
Length 753 bp
Fasta Format > whchul10g11
cattgcagcagccgctcccctcctcctattcctggccctggccgccatgg caggcgccgtgacgttcgacgcgacgaacacggttccggactccgccggc gggcagagattcgaccaggacgttggcgtcgactacgccaagcaggtgct ctccgaggcctcgtccttcatctggaccaccttcaaccagcccaacccgg aagaccggagggactacgactccgtcaccctcgctgtggttgacaacatc gagcctgtggcccagacctccgggaacgctatccaactccgagcccagta tgtcgccggcttcgacgagggcgacgtcaagaaggaggtgaagggcgtgc tgtaccacgaggcgacgcacgtgtggcagtggaacgggcagggcagggca aacggcgggctcatcgaggggatcgccgactacgtgcggctcaaggccga cctcgcgccgacgcactggcgcccgcaggggagcggcgaccgttgggacg aggggtacgacgtgacggccaagttcctggactactgcgactccctcaag gccgggttcgtggcggagatgaacagcaagctcaaggacggatacagcga cgactacttcgtgcagatcctggggaagagcgtggaccagctgtggaacg actacaaggccaagtacccccagccccagggctgatcgacgatgcatgca gtttgttgttgtatgtgtaccggtcttcgtctacatacagatacattata ctc
Download
page-top