Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ944181
Length 411 bp
Fasta Format > whchul10g03
agcttccgtctcgccgcgacgccaggcaatggtgtcccccggttgtccgt gacgtcagcccgctctgctgctcgtgtgagcaggaggagcatgaggctca agtccctgcgcgtcaggtgcgagcaggggtccaagggcggccccgggctg gacgtgtggctcagccgcggcgccatgctcgccttcttcggggcggtcgg cgtggagctcactaccggcaaaggggtgcttcagaacgtagggctgatgg cgccgctgccggcgttggcgctggggctcaccggagtggtcggggtcgtc accgcatttatcatcttccagtctggatcgtcggattgatcaatcgctcc atgttaatttgcgctgctgtgagaaaggaaaaaaaaatatctcgagttgt caaaaaaaaaa
Download
page-top