Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ944178
Length 380 bp
Fasta Format > whchul10e19
gcgttcctgtgcgtgatcctggccacggtcgcggtcgcggcggcgcggcg caggccctgctcgccgccagaggtgatttaagcactgtgaagcgagacag catgacaccgtatcggaatatctaccaggcaccttcttatgcggcgccga cggggccactcccaggatatcctcctccaaagtagtctggagccttggag gcgatcgacagttgaagcacgggaatacaagtgcagcgagtatgaataaa ttagttgccgagggtgtactcggtgttgatatataaacatagtgatgcac tgatgctcgattgtacatcgttccattcacctctccgaataaacgccacc gaatgactctgttgttagtcaaaaaaaaaa
Download
page-top