Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ944173
Length 688 bp
Fasta Format > whchul10e03
cggccagttctttgagtgcctgaacatggctcagctgtggaagcttccga ttatttttgttgtggagaacaacctatgggcaatcgggatgtctcacctt aggtctacttcagatcccgagatctggaagaagggcccagcattcggaat gcctggggtacacgtcgatgggatggatgtcctgaaggtcagggaggtgg ctaaggaggcaattgacagggcaaggagaggtgaaggaccaactctagtg gaatgtgaaacttaccggttcagaggccactctcttgctgatccagatga actcaggaggcccgatgagaaatctcactacgccgcaagggaccccatca cctccctgaagaagtacatcatcgagcagaacctcgcgtccgaagccgag ctgaagaacatcgagaagaagattgacgacgtcgtcgaagaggctgtgga gtttgccgacgcgagcccgctgcccccacggagccagctgctggagaacg tgtttgccgatcccaagggcttcggcatcggccccgacggcaagtacagg tgcgaggaccccaagttcacccaaggcacggcgcaagtctaagggccgct gctgcagaagcagcttgtttacgcctcttttctcatgtactacctctcta gctacctgcccctagttttgtcgatcccgccgtcgatt
Download
page-top