Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ944171
Length 568 bp
Fasta Format > whchul10c21
ttcatatcaaccgtccgatgaatggcggcactccggctcatgaccataag ccgcaggtcaccagctaagattgcttcatttcagcagttcatcgctcatg actttgatgccagtgaccacggcacttcaagcttcccggttgctgctgtt cacaggatcggcatattagacatcaggattttcaacactgacaggcatgg cggtaatgtcctggtgaggaagcttgatggaggcaccggtcgctttggtt gccagacagagctgttcccaattgatcatgggctgtgcttgccggagaac ttggaggacccttatttcgagtggatacactgggcacaagcatcaattcc gttctccgaggaagagctcgagtacattagcaaacttgatccgatgaggg atgctgcaatgctgcgcggagaactgccgatgatacgcgaggcttgcctc cgagtgcttattctatgcacaatcttcctcaaggaggctgctgctttcgg gctttgcttggcagagataggtgagatgatgaccagggaattcagaggaa tggaggaggaacccagca
Download
page-top