Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ944170
Length 703 bp
Fasta Format > whchul10c17
aagatgtctcagagtatatgattagtgctgcaaaagataacccccagtta gctgagaagatccatgctgtattactagaaaatggagttgtgccaccacc tgatttgttttcagaagaatctagggaacaaccaaaagacctaattgtgt atgacacatctctgtttcaaacgaaaggtgaaatgataaagcggatgaat gagcttgaatccacatcacatgatgaaagtgatcatggtccttcgttgcc acctcatcctggatatgaacaccaaacaaaggttgttccttaccggccta aacctgtccaaggaatgggtatttatcacccctcaaatttccatgataac agtaatccatctttacctctgtatgaatcatctgcacttgcccgggaata cccatttcaactcataaagcaaatgcctgttacagctgctgcagttgcaa ctgctgcagtggttgcatcttcaatggttgttgctgcagctaaatctaac agtgatattaaactagatgtccctgttgctgctgctgccactgctgctgc tgttgttgctacatccgctgctgttaagcaatatgaatacatggatccgg gttgtcaattgattagcttgcctagttcttcagaggcaaatggaccagtc catagagttcgacctgactgctgggataaagatcagctggaagttgatca tgg
Download
page-top