Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ944160
Length 753 bp
Fasta Format > whchul10a19
aagatggcttctgccactagcagcggcagcaagactctgagtgtcctgct cttcccccactttgcgaccagccacatcgagcccttcaccgagctcgccc ttcgcctcgcagcgtctaggccagacgccgccgtggaagcgaccgtcgcg gtcacgccggcgaacgtcccggtcgtccagtccttcctggatcgccgatg gcacgggcgtagcgcagcaaccgtcaggatagtgacgtatccgttcccaa cggtggagggcctgcccaagggcgtcgagaaccttgggaaggcggccact caggcggattccatgctcatcaacctcgctgcctcgagcgagaccctgat gcgccccgcgcaggaggcgctcatccgggcgcggtctccagacgcgatct tcaccgacatgctcttcacctggagcaccgacatcgccaacgagctcggc gtgccatgcgtcgcactcaatgtcgttggtgccttcccgatgctcgctat gcgccacctcctgatggaggacgctgcgatcgacggagatgacatggtga cagcccctccgtttccgatccctcctatacgggtcccgaggaccgagctg ccggacgtatcgatatttcgacacgtcttcggcaaggttcattccatgca agctgcctgcttcggcctcgccgccaacacgttctcaggcctggagcagc agtactgcgacatgtacatgggccaagggtacgtccagcgctcctacttt gta
Download
page-top