Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ247471
Length 423 bp
Fasta Format > whf2f16
ctcgacgacgccgcgcgatcctgcggaggcggcagtcatggtgcacgtca acttctaccgcaactatgggaagaccttcaagaagccaaggcgtccgtat gagaaggagcgtcttgacgctgagctgaagctggttggggagtacggtct gcgggccaagcgtgagctctatcgtgtgcagtacgccctcagccgcatcc gaaatgctgccagggagctgctcaccctggatgagaagaacccccgccgt atctttgagggtgcagcgctcctgcgccgcatgaaccgctacggtcttct cactgaggaacagaacaagcttgattacgtgcttgccctcactgttgaca acttcctccagcgccgtctccagaccatcgtcttcaagaatggcatggnc aagtcaatccatcatgctcgtgt
Download
page-top