Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ247470
Length 612 bp
Fasta Format > whf2f15
cgcacagctcgnacgacccgcgcgatcctgcggnaggcggcagtcatggt gcacgtcaacttctaccgcaactatgggaagaccttcaagtaagccaagg cgtccgtatgagaaggagcgtcttgacgctgagctgaagctggttgggga gtacggtctgcgggccaagcgtgagctctatcgtgtgcagtacgccctca gccgcatccgaaatgctgccagggagctgctcaccctggatgagaagaac ccccgccgtatctttgagggtgcagcgctcctgcgccgcatgaaccgcta cggtcttctcactgaggaacagaacaagcttgattacgtgcttgccctca ctgttgacaacttcctccagcgccgtctccagaccatcgtcttcaagaat ggcatggccaagtcaatccatcatgctcgtgtcctcatcagacagcgcca catcagggttggaaagcagctcgtcaacattccttctttcatggtgaggg tggacactgagaaacacgtcgacttctcgctcaccagccccctgggtggt ggccaacctggaagagtgaagcggaagaaccanaanaaggcctnangtgg tggnggngacna
Download
page-top