Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ932118
Length 632 bp
Fasta Format > whchan10f03
agtacagcaaactcggggagtggaagaacaaccaaacatcgatacaacag tgtggccggccatgcagagctgcttggacgtacgtactcctctctctctc acgcagtgagataatatgagagcatttattcatatatatatgtgggtgtg cgtgtgtgtgacctcaacgtactaagcgtagatccagcaacgatggcgta ggggacgatggcaacagcgatggcagcaagtgctcgatcagcgaatctta gagcagtcgaccgaagagctgatggcgtaagggacgctaacgccgcactt tgtggggatgccggcggccttgccagcgttgagcccagcagcagcgctct tgatgcacttgcacgccgcttgcttgtcagcggtgctccgggctgagctg gctagactcctaacgccgctgcagcaggccgcagatgggctggcgccgtt gccgcgtgcataggagatgcaggggctcaaggcagagctcacctgaccgc acgatacagccgcctccgtgactgcgaggagcatagcagccaccacggcg acgagcacgacctgagcaacagcagaacgggccatctcgatcaagctagc aatagtagtggtagtgagctcaggcagagatg
Download
page-top