Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ932110
Length 746 bp
Fasta Format > whchan10e15
aagatcgtgatgcacaatcaagggtttcttatcacaagaaacatcgaaac agagaagagtttccatgcctaacagaactacaaacgaagcacaaaaaact agctaggagcttattagttctgcagaggaatccaatcttctggtccacca tttgatcttcattggagcacagcagcggacaccgaagggcaagccgacca aacaccatagacatggtttggccgccgcaaagggggatcacaacccttcg aagaactcgctcatctcagcatcatggaaggcagggttgcgcatggcccg atcctctgatatccacattgggtaaggataatcagcttgcagcatgccct ccagcatgccttggtccaagccatccaggtagagaggttcctgcaggccc atctccacgccagtgttggttccacaattccaggagcccccagtgaccgg ctcaacttcaattgggtcggcttccatcaatctcagtaattcttctatat caaaaccgtctgcttccccatccggcaaactggaaataggctccaatggc tcgaacacatcctcttcggatgtgctccttgcaatgcttgagccagcatc aggaacagtgtctttatggctgtaatgctcgacagactccagcacaactg attcggtggactcaagcacatctggctgggagtaaatctcaagagcttga gcttgtcgcggcaagttagaagcaacatctgagtggttggctgatg
Download
page-top