Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ932093
Length 531 bp
Fasta Format > whchan10d19
aaagtttgtcatcgccacatatattagcgtggttgcaaaatagtactatt tattacacagctatttttctttgtgtagcatgcatgcaatcggcgtcaac ttgcactgaatcgtggcgtcaaccacatcaatcagctcgatcgttgccac ataaaataattctagaactcgtaatcatatcgcaacgtcgccatcgctgc agatatataacggtgattcatgtgttggccacaacttgcatggtcttgcg gcgtggagtcggcggggatgtcgcctgtggaggtggttcaggaaccgttc tgcagccataaatttgcctgcacggctgtcccgtgtagggtcccccatgc gccgcagaatggggaaccggcgacggagggggctttagtggcccatggag tccgtcgggaacaactcggattgccgtcgctgagcgtggcgtgcaacagc agatgattgccagcaccgccaccgcgagagcgagggaggaaggacgcgcc agcgccatgatcctcacgtagccagcttctc
Download
page-top