Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ932092
Length 808 bp
Fasta Format > whchan10d16
tattacatattggtgcatacgagaataataatctgctgtctgaattccag tcaaaattttagtactactaataatagcaccacctagaggaataatgaac aagtatcagaaccggatatcaccaataatcagttatttaccggacgcgac acagtacaacccggcaccgtgattgcagaaagaaagagatgtctacttta tcaacatgctgcgccatatgccgccaacagaccgagtacagtgacaccat aacaacagacctccaaaaaattctgaggtaagacaagctcgagcagctcg actagaccatgttcaattcaagcgaccacttttgcatcttgggcacaagg cagggcaatctaatgcaaattgtacagcagaatatcaatacatcagcccc tgagctatttagacaggaatggcctcgccggttccccaagcacctgcact gcacctccatgagatcacaagccatcccggcatcgagcaccatggtgaac aaaactgtgatataaggctacccccggatccactttatttctcctgactt tcctccttttcctgcttctgctcagccaggggagattccacattagcgct tccatcagctggttcagaatggccagttgaattgacatccggcgaatgtg gtaatgtcttttctactgtggtatcaggagccgaggattcaaccaaattc tcacttccttgttcttctacttgtcctgtaccaggcataccgccatcagt ggcatccatcaccttctcacttccagtttcactacatggaacgncagtat tctctgat
Download
page-top