Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ932079
Length 704 bp
Fasta Format > whchan10d03
ccaaacatgcatcattgcattgtttacggtacacacaagtctcgtgatgc tacagaccaaaagtacaacaaaacttccagcccaggtgatatgattggca cccaggactgaaacaaatggcgtatagtgtattttctcactatatcaaag agaataacttagtcgacctcctcgatcttggggccagcaccgccgctggc agccggcgcgtcctcgtccatgcctccgggcatgtcagcaccggcaccct ggtacatcttggcgatgatggggttgcagaggccctccagctccttcatc ttgtcctcaaactcgtcaacctcaccaagctggttggcgtcaagccactg gatcgcggcgtcgacagcatcctcaatcttcttcttgtcgtcagcaggca gcttggaggcaatcttctcgtcctggatggtgttcctcatgttgtaggcg tagttctccagggagttcttggcatcaaccttcttcttgtgctcctcatc ctcagacttgtacttctctgcatcctggaccatcttctcaatgtcgtcct tgctcagcctgcccttgtcgttggtgatagtgatcttgttcttctggcca gtggtcttgtcctcggcagagacattcaggataccgttggcatcaatgtc gaagcagacagtgatccggggaacacccctgggtgcaggcgggatgccgg agag
Download
page-top