Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ932076
Length 776 bp
Fasta Format > whchan10c23
gcagacttgctttttgttcccatacacttaccagtagcacaaaaagcgac tagtatccagcgtgtccaatttcaattcccggtattgctagttacatgtt ggtcgatgggtaactacatcgtatcggtgtatcaccagcttcctcgaggg gcttgcggcgtctgttgaacggccgctagtgggttcatctggacggagaa ggcgagttggagggcgtcgaggaacgcccgtcgcagggacgaagcgtgtt ggaacacaaccctctttaagccggcgcctttcctccggaggacgtagact gtcgagaacaacagcgagaacagaagcattagcttaccacttggtagaac aatgtgcattctgccaaactttacgcgcaccgaatggaaccaccaaaaca tgggatcaaagttatttgcgacgcgctgaagggaaggctcaatggacttt ggtaagccatttgttttcacattgggtgcacgcgtggtgcttgctggggc atcctcgtgtgttgctggtgttgggcctttgtcaaaagcagaaaggttcc tctctgttgattgttttgatcctctagcagtggatgacttttcatttgca gctgcttgtaatgcatgaagtttttcaagtagctcctgtcgatcttgctc aattagttctgccttctctacccatgagatggcattttcaggctcatcag aggcaatgctaaggaatgtaactgtatacaattctaccacctccaaatac tctncagttgccatagttgatgtanc
Download
page-top