Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ932071
Length 423 bp
Fasta Format > whchan10c17
tatcataacttccagacaccgcggctaccattcacacaaacaaaaagcat catcaactccaaactccatccatgccaggaatgaaaatgctccatctaac taacagcacccattattgtcaatacaaaccaaacccatggtcctgggcag gttgagaggcagcagctagttaagggagagcatttgtttatgaggatccc ggggtggaggtgcttgcggcggcggaggcggcagcctcctccttcttctt aaggtcctcaaacttgttgatggtgacctgcagctcgtcggtgctgccca ccgcccacatggtgtagtagtacaccccgaagacgaaccccgtcagcccg cccgccaccaccacgttcttcgtcttgggcgccaggctgccgaaccctgc catcgacgacgacgaggaggttg
Download
page-top