Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ932069
Length 664 bp
Fasta Format > whchan10c14
acctacnaagcttcnaggtaccaatcacacgnttcgtatctnatttgcct agtgacnaattggatttgatcagaagcatcctttacagattcaacagcgg cacttgctctgcaagtttgcaccagattgttgacattattgtataccact actacactactatgtctaatctactggtggaatgaagtgccatgttggtt cgatatgtcttgtcttgacaaatgttggaagtcaggcggntgttatgccg accgccatcggatcttcaggtatccgaatttgccagcaccgggagacgaa ccctcgaagacaattggtangtaaccggnggctgctttgtatcttttctg gatctcgaaaatctcttcactacttttcaggctatttttcccaataacac naactgaaccaccanaacctccaccantgatctttgcaccaaatagactc gggccttcatgttgcgaggtggtcttcctgtgctggatttcttgtactag attcaccagcctatcagtcccatcagaaccaagcccgcaagcattgtanc tgtaatggcactgatacataagttctccaagggctgaaagttgctcatct gttttggctgctgttaacaatgctttgaaggcctcaacacggcaagttct cgtatatggaatgt
Download
page-top