Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ932066
Length 571 bp
Fasta Format > whchan10c09
gcaatttattgggatacaagtagagatcaaaccaccccacaaaaaaccta tcttctttgtaggttatttgtcaatcgtctgagaagtaacgacgccatat atttgtagagcacactagtcacaatatcccagatacatactgaaacgtaa cacaaaaagggaaaccaagccatgtactccctctgttgcataatttgaat tgaaaccatgacaataattcaaatttgaactaaaaccacaacagtaatta tggaacagaggaagtaaataatttacgcagctcggttaattccagaagaa actggcgtcaatgacgagttcatggacgcttgaatctcttccagggtcct tcctttagtctctggtaccagccgctccacaaatacaacagtcagcccgc aaatggtcgcgaacatgaaaaatgtaccataggagctccacagcaggagg aagttgaaggcatacgagacgatccatgagccgagccagctcaccaaggt caccaggcttcctgctgaccctttcatgtgtatggggaagatctctgaca ttataacccatggaattcctc
Download
page-top