Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ932049
Length 764 bp
Fasta Format > whchan10b12
atttattagttattaacagagtacaaaacaaagtgaatcataaccaaact gttacaagatacgaaagaaacactaaatattaagtcaacttcttccatag caatgcctttaagaagggataatcgtcctcatgccatcattgccacgtcc tgccgaggatggtctggacaagaattttcatcctgattgctgaccggcca atgaagatcagcaccacaacaagtagacaacgccttcaacaagataatga cgtaggatcttcgttgccgagcccaaccattaaaggccagtactagggtt ttcaccccgggtgaagtgatgtttcagtcggcatcttgatcaccgattga ttgatagtcacatctcccgatactccatgccaggccaagaaggcacctag acaccaccatggctgtcaggtggctgtccatgtctcggtgcggaactagc cgctgccactccacaccggtgcaagtcatactgcatcatccagcatacca tcgaagctgctacgccggtgctagatgtcggcgtagaaccaccagcgcgc ctctcgctcacatgtgtctgaaactgaagtcggcgccatgaatctcctcg tgtgatagccgttgctctcacgctagaagaaaattctcttaacactgtca gcaatcgcctgttgcgttgcagccgtcgggccttcatttgcatcactgcg ccctttgatctctttgtcggggttgtcgagggccgacgtgatgaccaacg ganactgtcgcctc
Download
page-top