Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ932047
Length 206 bp
Fasta Format > whchan10b10
gtacaaaggataaaaatatcatgatattaaattggcatgcttaaaaggng taaaggcanctgccgtcgtcactcctcgccgttgggtcgaagttcttggc agtctggtcngtgcatcctgccggcacangcaaagtaccttgctgtgccc ctttacctcctcctatgcancaagagatggngggtgtgtatggagaatgt tctaac
Download
page-top