Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ932044
Length 445 bp
Fasta Format > whchan10b07
gatgtggtgtactccactattatagagtctaagcgatttgctgatggggc tcttttgagatttgatcatatggaactcgaatagattacactctgtgagt accaaacgaacaacaaaggaggcaacaaactcgccacgcccctttgccct cctgacgtgacctgagcataggcggacggatcttcgctcacgttctagcg tttctctttctcccatacccatctgctcggcctgaatatctgccgcagga gcgccatcttggggacgttccagttttcgacatgcctgcacaccttcccc gactcggcatcgaagtagtactccgtgtacccggttgcggagagaatggg cctccacgggaacgacatgacgcagctgaaacgccagtgcccgatcgatt tgtcctcgacatcctcccatttggtcagcttcatgttggacttct
Download
page-top