Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ932040
Length 763 bp
Fasta Format > whchan10b02
attatgtacgctttgacagtaacattggaggatactttacatgaatgaag ggagggggagaaaaaaagaacagaaaatcaacctcagattacaattgcat cagttgatgccgccgctagtgtacaattaacaatacacaattgcaatgat ggtgcccattatccttttcacagggcttccttcccagaatccttctatct gtagcaatatttggccagatgaacaaccgcgctgcgacgcacgaccaaat aatctgtgcatacgggtcatctgtctgccattgccaggcaaagaaatggc acgagagagaaagagactacaggtgatgtcatgtgtttgcctatgatcca ctctcaatttcgttgctgaacggtaaccgatcgacacccctctcgactgc atccctccatagccgataccggatgccgagcttgtcatacgacactggcc agttccaaacgttagctccattgttcattcggtcttgttggccgagcaca agccgcagatcctcattcaagaccttctcagcgaaatgtgaccacaacag gtgcatgaaaggcatgtgcttcatccagggtgcgaagtcgagagacatcc ggtacaacagcctggttttattcgtcgatgagggcaagcatacatggagc tggtggagatgcgttgcacattgttgggtgctcttcccttctagctttcc aggcttggagatgccnatggttgacnagaccatgcagggcggtcggaact ccatatcgatggg
Download
page-top