Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ932037
Length 716 bp
Fasta Format > whchan10a22
ttcgacagactaaagaaccagatggtatgatattgtttgacatggagggc atgacgatcatgctcctcgagcttttattgctaagttcaatttacgtaat gcgtgcacaaaatcaattgaccggtaatctcttcgacacacacacataaa acagatatggtaggtgctaccatggccttgctcaggctggaacttcgtcg gaacaagggtatgtctgcagaacgtaaaccgggtcgccgaccttgacgat cctccctttgccctttgctgacaccgactccttgcagaccaggttttgcc caaagtataccttctgtttattcttgtggctcgggcggatcacttcaccg gaccggaatgtcagcatggtttctgttggttcgctgccaggtattccgtt ctcttgattaatggtaggcaccttgcaacggtcgcataacttcacgccgt caaatgttagcttgtttatcttcatggttttccacagatcctctgcgtac gggtggcatccgtccactaaaatatttggtctgaagcgattgattggtac aggttccttaagcagctcattcagtgcatccagtgatccctgggatgcta tcaggaacgggaagcaatccgtgaaggtgatcttgtagccttgagcatac tcaggattagtcggcctgatttcggactcttctttaaaccgcacgagccg acttggtttcccgaaa
Download
page-top