Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ932035
Length 489 bp
Fasta Format > whchan10a20
atacaagagcttattcacggagcaacaacaggtttttcttaagaagaaga aaagataaagactgaggacaacaacaacaattgttgttgggcgtggacca cgtgcacgtacaaccacaacagctccgctcaacccatctgagcttttatt atcggcacaccatcttattgaacatgagcgatcagtacttcttgcagggc gggcagggcgtgccgtcgtcgccgcgtgcatcggcgcaccggaacgtctt cgtggggctcgtctgcacgacgcggcagttcacgcagccgtcgcggcact tggggccggcgtcgtcacagaccacggcccccgagaagaacctacagttg tcgcagcacttcgggaactcggcgttcgcttgtgagaggattcccatgac caggacggcctggagaatcaggatcgccacgagcgtgctactcttcattg ttgcttctacacttctctagcaaagttctcgccttgtcc
Download
page-top